Table 3 Primers used for the construction of FL-RrgB-Spn

The plasmid used was pMU1328 FL-rrgB-Spn. Underlined sequences correspond to the restriction recognition sites. The bold underlined sequence encodes the 6×His tag protein fragment. Sequences in italics represent the complementary bases allowing the fusion PCR reaction.

SectionAmplification primers (5′–3′)
Promoter region
 ForwardGTGCGTGGATCCGATGATATCAAAGACAGATTGAAA
 ReverseATTCGAAAATTCTCCTTCTTTCTA
Gene
 ForwardTAGAAAGAAGGAGAATTTTCGAATATGAAATCAATCAACAAATTTTTA
 ReverseCAGCGTGTCGACTTAATGGTGATGGTGATGGTGAGTGATTTTTTTGTTGACTACTTT