Table 1 Quantitative RT–PCR primer sequences
TargetForward primer (5′→3′)Reverse primer (5′→3′)
c-FosCTACTGTGTTCCTGGCAATAGCAACATTGACGCTGAAGGACTAC
Egr-1ACAGAAGGACAAGAAAGCAGACCCAGGAGAGGAGTAGGAAGTG
Nur 77CCTGTTGCTAGAGTCTGCCTTCCAATCCAATCACCAAAGCCACG
Nor-1GCCATCTCCTCCGATCTGTATGGAGGCCGTCAGAAGGTTGTAG
18s rRNAGTAACCCGTTGAACCCCATTCCATCCAATCGGTAGTAGCG
IL-10CCCTTTGCTATGGTGTCCTTTCGATCTCCCTGGTTTCTCTTCCC
IL-6TTCCATCCAGTTGCCTTCTTGAGGTCTGTTGGGAGTGGTATC
TNFCAGACCCTCACACTCAGATCATCGGCTACAGGCTTGTCACTCG