Table 1 Strains, primers and vectors used in the present study
DescriptionSource
Strains
T. thermosaccharolyticum E207-71Wild-type strain
A. thermoaerophilus L420-91TWild-type strain
E. coli DH5αφ80 lac ZΔM15 Δ(lac ZYA-argF) U169 recA1 endA1 hsdR17 (rk, mk+) phoA sup E44 thi-1 gyrA96 relA1λInvitrogen
E. coli BL21(DE3)[F ompT hsdSB (rB mB) gal dcm (DE3)]Invitrogen
Primers
 wQdtB_for1GARGGNGAYGARGTNAT
 wQdtB_rev1GCNGCYTGNARYTCRTC
 gQdtA_for1GCATTTTGTATAACGTTGCGTTAATA
 gQdtA_rev1TTCATTTTTGCACTCTCTCC
 gQdtB_for1GCATGAAAATATCATTTGCAAGCT
 gQdtB_rev1GCTAATAACACTTCCTAATCCG
 gQdtC_for1GCATGCCAAATAATATTTCTAAAAGTG
 gQdtC_rev1CGTTATACAAAATTCTTCCCCC
Vectors
 pBCKS IIChromosome walkingStratagene
 pDonr201Cloning vectorInvitrogen
 pDest15Expression vector (GST tag)Invitrogen
 pDest17Expression vector (His tag)Invitrogen
 gFdtA15FdtA in pDest15[15]
 gFdtB17FdtB in pDest17[15]
 gFdtC15FdtC in pDest15[15]
 gQdtAQdtA in pDonr201The present study
 gQdtBQdtB in pDonr201The present study
 gQdtCQdtC in pDonr201The present study
 gQdtA17QdtA in pDest17The present study
 gQdtB17QdtB in pDest17The present study
 gQdtC15QdtC in pDest15The present study