Biochemical Journal

Research article

Galactose induction of the GAL1 gene requires conditional degradation of the Mig2 repressor

Mei Kee Lim, Wee Leng Siew, Jin Zhao, Ywee Chieh Tay, Edwin Ang, Norbert Lehming

Abstract

Skp1 an essential component of the SCF (Skp1/cullin/F-box) E3 ubiquitin ligases, which target proteins for degradation by the 26S proteasome. We generated a skp1dM mutant strain that is defective for galactose induction of the GAL1 gene and we have found that galactose-induced protein degradation of the repressor Mig2 is defective in this strain. Mig2 degradation was also abolished in cells lacking the protein kinase Snf1 and the F-box protein Das1, suggesting that Snf1 triggers galactose-induced protein degradation of Mig2 by SCFDas1. Chromatin immunoprecipitation showed that Mig2 associates with the GAL1 promoter upon the galactose-induced exit of Mig1 in skp1dM cells, but not in wild-type cells, suggesting that the conditional degradation of Mig2 is required to prevent it from binding to the GAL1 promoter under inducing conditions. A galactose-stable deletion derivative of Mig2 caused a strong Mig (multi-copy inhibition of GAL gene expression) phenotype, confirming that galactose induction of the GAL1 gene requires the degradation of the repressor Mig2. Our results shed new light on the conflicting reports about the functional role of the degradation of transcriptional activators and indicate that gene expression studies interfering with proteasome degradation should take the stabilization of potential repressors into account.

  • galactose induction
  • GAL1 gene
  • Mig2 repressor
  • protein degradation
  • transcription
  • ubiquitin

INTRODUCTION

The Saccharomyces cerevisiae GAL genes have been a paradigm for eukaryotic transcriptional regulation for the past few decades [1]. In cells grown with glucose, Gal80 binds to Gal4 and blocks its activation function [2], and Mig1 binds to an upstream silencer and recruits the general repressor Tup1 to prevent gene expression [3]. Upon the switch to galactose medium, Snf1 phosphorylates Mig1, causing its translocation from the nucleus to the cytoplasm [4], and Gal3 sequesters Gal80 in the cytoplasm [5], leaving Gal4 free to activate the GAL genes, which are required for galactose utilization [6].

Proteolytic stability of transcription factors offers an intriguing possibility for the eukaryotic cell to control gene expression [7]. Ubiquitin proteasome-dependent degradation of activators and repressors plays an important role in gene regulation [8], and treatment of S. cerevisiae cells with the proteasome inhibitor MG132 abolished galactose induction of the GAL1 gene [9]. Ubiquitin is a small protein of 76 amino acids that is transferred by E3 ubiquitin ligases to proteins to be targeted for degradation by the 26S proteasome [10]. F-box proteins confer substrate specificity to SCF (Skp1/cullin/F-box) E3 ubiquitin ligases [11]. When cells are grown with galactose, an SCF E3 ubiquitin ligase containing the F-box protein Mdm30, SCFMdm30, ubiquitinates Gal4, which leads to its degradation under activating conditions [12]. The deletion of MDM30 reduces poly-ubiquitination of Gal4, stabilizes Gal4 under inducing conditions and leads to defects in galactose utilization, suggesting that recycling of Gal4 is required for its transcriptional activator function [12]. Subsequently, however, it was argued that the deletion of MDM30 has no effect on the amount of ubiquitinated Gal4 and that Gal4 remains stably bound to the enhancer under inducing conditions, indicating that proteolytic turnover of Gal4 might not required for its function [1316]. Previously, it had been shown that mono-ubiquitination protected Gal4 from the promoter-stripping activity of proteasomal ATPases [1719], suggesting a role for ubiquitin in transcriptional activation other than protein degradation. Recently, it has been reported that the proteolytic stability of Mediator subunits is inversely correlated with their ability to activate transcription when fused to a DNA-binding domain [20].

In the present study, we have identified Alpha2 and mig2 as suppressors of the transcriptional defects of a skp1dM (Skp1V90A,E129A) mutant strain. We have shown that the repressor Mig2 is stable in wild-type cells grown with glucose, but degraded upon galactose induction and that this conditional degradation was abolished in the skp1dM strain. The galactose-induced degradation of Mig2 is triggered by the Snf1 kinase, as Mig2 is stable in galactose-induced cells lacking Snf1. ChIP (chromatin immunoprecipitation) showed that in skp1dM cells, but not in wild-type cells, Mig2 bound to the GAL1 promoter upon the galactose-induced exit of Mig1 [21,22], indicating that galactose-induced protein degradation of Mig2 is required to prevent it from binding to the GAL1 promoter under inducing conditions. The F-box protein Das1 was found to mainly target Mig2 for galactose-induced protein degradation. Galactose-stable deletion derivatives of Mig2 inhibited transcriptional activation of the GAL1 gene, confirming that galactose induction of the GAL1 gene requires protein degradation of Mig2.

MATERIALS AND METHODS

Strains and plasmids

The SKP1 gene of the S. cerevisiae strain JD52 [23] was replaced by the HIS3 gene with the help of puc8+HIS3-PTskp1, a derivative of puc8+HIS3 [24] that carried the HIS3 gene flanked by 511 bp of the SKP1 promoter and 536 bp of the SKP1 terminator (see Supplementary Table S1 for the sequences of the PCR primers and Supplementary Table S2 for the genotypes of the strains; both at http://www.BiochemJ.org/bj/435/bj4350641add.htm), in the presence of 316-Skp1, a derivative of the URA3-marked single-copy vector RS316 [25] that expressed Skp1 from the ACT1 promoter [26]. Nub-HA–Skp1wt (where Nub is the N-terminal half of ubiquitin, HA is haemagglutinin and Skp1wt is Skp1 wild-type) and Nub-HA–Skp1dM were expressed from the single-copy vector PACNX under the control of the ADH1 promoter [26], and from its derivative PSCNX under the control of the SKP1 promoter (a 925 bp genomic DNA fragment from −931 to −7, which had been used to replace the ADH1 promoter in PACNX). The MIG2 gene of JD52ΔSKP1+Nub-Skp1wt was knocked out with a derivative of NKY51 [27], which contained a 407 bp MIG2 promoter fragment and a 377 bp MIG2 terminator fragment flanking the hisG-URA3-hisG cassette. Nub-Skp1wt was replaced by 316-Skp1 via plasmid loss, and plasmid shuffle was used to generate the SKP1wt and skp1dM strains carrying hisG in place of MIG2. BY4741ΔW and BY4742ΔW and their gene deletion derivatives were obtained from the respective EUROSCARF strains by inserting hisG into the TRP1 gene with the help of NKY1009 [27]. 314-Alpha2 is a derivative of the TRP1-marked single-copy vector RS314 [25], over-expressing Alpha2 from the ACT1 promoter. 112-Alpha2 was isolated from a YEplac112 [28]-based genomic DNA library (a gift from Professor C.P. Hollenberg, Institute for Microbiology, Heinrich-Heine University, Düsseldorf, Germany) as a multi-suppressor of the gal phenotype of the skp1dM strain. 112-Alpha2 contains a 1513 bp genomic DNA fragment with the entire Alpha2 gene, including a 413 bp promoter and a 467 bp terminator. 112-SGT1 (where SGT1, suppressor of G2 allele of skp1) was isolated as a multi-suppressor of the ts (temperature-sensitivity) phenotype of the skp1dM strain from the same library. 112-SGT1 contains a 2255 bp genomic DNA fragment with the entire SGT1 gene, including a 318 bp promoter and a 752 bp terminator. 424-HA–Mig1 is a derivative of the TRP1-marked multi-copy vector RS424 [25] over-expressing HA–Mig1 under the control of the ACT1 promoter, while 314-HA–Mig2 and 424-HA–Mig2 are derivatives of the TRP1-marked single-copy vector RS314 and of RS424, respectively, over-expressing HA–Mig2 from the ACT1 promoter. Mig1 and Mig2 lacking their stop codons were cloned into Pcup1-Cub-RUra314 [29] to express Mig1-Cub-RUra3 and Mig2-Cub-RUra3 from the CUP1 promoter. C-terminal EcoRI-SalI fragments of both genes lacking their stop codons were cloned into YIplac128-HA3-H10, YIplac211-HA3-H10 and RS304-Myc9 [30] and integrated into the chromosome to express Mig1–HA3-H10, Mig2–HA3H10, Mig1–Myc9 and Mig2–Myc9 from the endogenous promoters. Tup1 and Das1 were cloned into PACNX and expressed as Nub fusion from the ADH1 promoter. 316-HA-Snf1 and 316-HA-Snf1T210A are derivatives of RS316, expressing HA–Snf1 and HA–Snf1T210A from the ACT1 promoter.

mRNA quantification

S. cerevisiae cells were cultured in synthetic complete 2% (w/v) glucose medium at 28 °C. At D600=1, the cells were collected by centrifugation. Galactose induction was performed by resuspending the cells in 2% galactose medium and incubation for the indicated amount of time. Total RNA was isolated using the RNAeasy Mini Kit (Qiagen) according to the manufacturer's protocol. cDNA was generated by reverse transcription–PCR using Taqman® MicroRNA Reverse Transcription Kit (Roche Applied Biosystems). Real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems). Primers used for ACT1 were GACCAAACTACTTACAACTCCA and CATTCTTTCGGCAATACCTG. Primers used for GAL1 were ACTTGCACCGGAAAGGTTTG and TTGGTACATCACCCTCACAGAAGA.

Dephosphorylation

Yeast cells were cultured as described above. The cell pellet was suspended in 1 ml of yeast lysis buffer (100 mM Tris/HCl, pH 7.5, 50 mM KCl, 1 mM EDTA and 0.1% Nonidet P40), pipetted into a screw-cap microcentrifuge tube containing acid-washed glass beads (Sigma–Aldrich) and 2 mM PMSF was added. The tube was subjected to homogenization with a bead beater for 1 min and then rested on ice for 3 min. This process was repeated three times. The sample was then centrifuged for 15 min at 4 °C, 13000 rev./min in a microcentrifuge and aliquots of the supernatant were incubated with 10 units of CIP (calf intestinal alkaline phosphatase; New England Biolabs) for 1 h at 37 °C in the presence of 1×NEB Buffer 3 (50 mM Tris/HCl, pH 7.9, 100 mM NaCl, 10 mM MgCl2 and 1 mM dithiothreitol).

ChIP

Yeast cells were cultured as described above. Chromatin cross-linking was performed with 1% formaldehyde for 20 min at 28 °C with gentle agitation. Yeast cells were harvested, resuspended in 1 ml of yeast lysis buffer containing 2 mM PMSF and transferred to a screw cap tube containing acid-washed glass beads. Cells were lysed using a mini-bead beater. Yeast lysates were collected and centrifuged at 4 °C, 13000 rev./min in a microcentrifuge for 10 min. Pellets were resuspended in 500 μl of yeast lysis buffer and sonicated. Sonication was performed using a cup-horn sonicator (Vibra-Cell™ from Sonics) at 40% maximal amplitude for 30 s for a total of ten times. Sonicates were centrifuged at 13000 rev./min in a microcentrifuge for 20 min and the supernatant was transferred to new microcentrifuge tubes. The DNA concentration of the supernatant was determined using a spectrophotometer (Nanodrop ND-1000) at 260 nm. The chromatin solution was then subjected to immunoprecipitation. This was performed by incubating samples with anti-HA beads or with anti-Myc beads (Sigma) overnight at 4 °C followed by washing of the beads. A total of 15 washes were carried out in the following order: four times with yeast lysis buffer, four times with yeast lysis buffer containing 0.5 M NaCl, 4 times with ChIP wash buffer (10 mM Tris/HCl, pH 8, 0.25 M LiCl, 1 mM EDTA, 0.5% Nonidet P-40 and 0.5% sodium deoxycholate) and three times with TE buffer (10 mM Tris/HCl, pH 7.5, and 1 mM EDTA). Next, the chromatin DNA bound to the beads was eluted with ChIP elution buffer (50 mM Tris/HCl, pH 7.5, 10 mM EDTA and 1% SDS) by heating at 65 °C for 10 min. Reverse cross-linking was then performed using 20 mg/ml Pronase (Roche) and ChIP products were extracted with phenol/chloroform (1:5,v/v) (Bio-Rad) and purified with ethanol. Finally, real-time PCR was then carried out to quantify the amount of DNA present. Primers used to detect Mig proteins at the GAL1 promoter were TAACCTGGCCCCACAAACCT and CGGCCAATGGTCTTGGTAAT.

RESULTS

Alpha2 was isolated as a multi-copy suppressor of the transcriptional defects of a skp1dM mutant strain

Skp1 is an essential component of the SCF E3 ubiquitin ligases, which target proteins for degradation by the 26S proteasome [11]. We performed an alanine-scanning mutagenesis of the SKP1 gene in S. cerevisiae in order to isolate gal alleles and use these to study the role of conditional protein degradation in the galactose induction of the GAL1 gene. No single Skp1 alanine point mutation was found to cause a gal phenotype, but the double mutant fusion protein Nub-HA–skp1dM caused ts and gal phenotypes when expressed in place of wild-type Skp1 (Figure 1a, compare lines 1 and 2; also see Supplementary Figure S1b at http://www.BiochemJ.org/bj/435/bj4350641add.htm). Real-time PCR quantification showed that galactose induction of the GAL1 mRNA was abolished in the skp1dM strain (Figure 1b). We performed a multi-copy suppressor screen of the ts phenotype of the skp1dM strain and we isolated SGT1 (Figure 1a, compare lines 2 and 3; Supplementary Figure S1b). SGT1 had been isolated previously as a multi-copy suppressor of the ts phenotype of another skp1 allele, and Sgt1, which associates with Skp1, is required for Cln ubiquitination and cell cycle progression [31]. Next, we performed a multi-copy suppressor screen of the gal phenotype of the skp1dM strain and we isolated Alpha2 (Figure 1a, compare lines 2 and 4; also see Supplementary Figure S1b). Real-time PCR quantification showed that, in the skp1dM mutant strain, galactose induction of the GAL1 mRNA was restored to some 370-fold in the presence of excess Alpha2 (Figure 1c).

Figure 1 Alpha2 isolated as a multi-copy suppressor of the transcriptional defects of the skp1dM mutant strain

(a) S. cerevisiae cells expressing Nub-HA–Skp1wt (SKP1wt; line 1) and Nub-HA–Skp1V90A,E129A (skp1dM; lines 2 to 4) in place of endogenous Skp1 from the ADH1 promoter were serially diluted 10-fold, titrated on to the indicated plates and incubated for 3 days at 28 °C (Glucose 28 °C), for 3 days at 33 °C (Glucose 33 °C) or for 6 days at 28 °C with 1 μg/ml Antimycin A (Galactose+AA). Cells in line 3 contained the SGT1 gene on the multi-copy vector YEplac112 and cells in line 4 contained the Alpha2 gene on the multi-copy vector YEplac112. (b) Cells of the indicated genotype that expressed the Skp1 derivatives from the SKP1 promoter and contained the single-copy vector RS314 were grown in glucose liquid medium to D600=1 and induced with galactose liquid medium for 4 h or 8 h as indicated. Total RNA was isolated and GAL1 mRNA was determined relative to ACT1 mRNA by quantitative real-time PCR. The value determined for SKP1wt cells grown with glucose liquid medium was set as 1 and the error bars indicate the S.D. values between three replicates. (c) skp1dM cells that expressed the mutant Skp1 protein from the SKP1 promoter and contained RS314 or RS314 over-expressing Alpha2 under the control of the strong ACT1 promoter were grown in glucose liquid medium to D600=1 and induced with galactose liquid medium for 4 h or 8 h as indicated. Total RNA was isolated and GAL1 mRNA was determined relative to ACT1 mRNA by quantitative real-time PCR. The value determined for SKP1wt cells grown with glucose liquid medium was set as 1 and the error bars indicate the S.D. values between three replicates.

Galactose induction causes SCF-dependent protein degradation of Mig2

Alpha2 represses the a-specific genes by recruiting the general repressor Tup1, which is also used by Mig1 to repress the GAL genes [32]. Our observation that the over-expression of Alpha2 suppressed the gal phenotype of the skp1dM strain suggested that SCF-mediated conditional degradation of Mig1 could be required for galactose induction. Endogenous Mig1 protein was C-terminally tagged with nine Myc tags in the SKP1wt and skp1dM strains. Consistent with a previous report [33], a 1 h galactose induction caused a shift of Mig1 protein in the Western blot due to phosphorylation (Figure 2a, compare lanes 1 and 2), but no difference was observed between the SKP1wt and skp1dM strains (Figure 2a, compare lanes 2 and 4). However, when endogenous Mig2 protein was C-terminally tagged with nine Myc tags in the SKP1wt and skp1dM strains, Mig2 protein disappeared after 1 h galactose induction from the SKP1wt strain, whereas it remained in the skp1dM strain (Figure 2a, compare lanes 6 and 8), indicating that wild-type Skp1 was required for galactose-induced protein degradation of Mig2 and that excess Mig2 protein might have interfered with galactose induction of the GAL1 gene in skp1dM cells. In this case, the over-expression of Alpha2 had suppressed the gal phenotype of the skp1dM strain by titrating the Tup1 co-repressor away from GAL1 promoter-bound Mig2. According to this hypothesis, Mig2 would have to interact with Tup1, which had not been shown previously. We used the split-ubiquitin assay [34,35] to demonstrate that Mig2, similar to Mig1, interacted with Tup1 (Supplementary Figure S2b at http://www.BiochemJ.org/bj/435/bj4350641add.htm).

Figure 2 Skp1 mediates galactose-induced Mig2 degradation

(a) Endogenous Mig1 and Mig2 proteins of SKP1wt and skp1dM cells expressing the Skp1 derivatives from the SKP1 promoter were C-terminally tagged with nine Myc tags. Cells were grown to D600=1 in glucose (Glu) liquid medium (odd lanes) and induced with galactose (Gal) liquid medium for 1 h (even lanes). The upper panels present Western blots using anti-Myc antibody and the lower panels present the same membranes that had been stripped and stained with Coomassie Brilliant Blue as loading controls. (b) HA-tagged Mig2 was expressed in SKP1wt (wt, wild-type) and skp1dM cells from the single-copy vector RS314 under the control of the ACT1 promoter. Cells were grown in glucose liquid medium to D600=1 (lanes 1–4 and 9–12) and induced with galactose liquid medium for 5 min (lanes 5–8 and 13–16). Cycloheximide was added at t=0min (lanes 1, 5, 9 and 13) and the amount of Mig2 protein remaining in the cells after 5 min (lanes 2, 6, 10 and 14), 10 min (lanes 3, 7, 11 and 15) and 15 min (lanes 4, 8, 12 and 16) was determined by Western blot using an anti-HA antibody. The Nub-HA–Skp1wt and Nub-HA–Skp1dM proteins expressed from the SKP1 promoter served as loading controls. Standard molecular masses are shown between the blots in kDa (kD).

Cycloheximide blocks protein biosynthesis, and in order to show that the differences in Mig2 protein expression were due to differential protein degradation rather than to differences in gene transcription, we performed the cycloheximide chase assay with HA-tagged Mig2. In SKP1wt cells, HA–Mig2 protein was stable when the cells were grown with glucose (Figure 2b, lanes 1–4), whereas it was rapidly degraded when the cells were induced with galactose for just 5 min before the addition of cycloheximide (Figure 2b, lanes 5–8). On the other hand in skp1dM cells, HA–Mig2 protein levels remained stable upon galactose induction (Figure 2b, lanes 13–16), confirming our hypothesis that Mig2 is degraded upon galactose induction via SCF E3 ubiquitin ligases. Consistent with this hypothesis, Mig2 was found to be ubiquitinated in vivo (see Supplementary Figure S3 at http://www.BiochemJ.org/bj/435/bj4350641add.htm). However, we were only able to detect a mono-ubiquitinated form of Mig2 in a proteasome-deficient strain grown with glucose. Upon galactose induction, mono-ubiquitinated Mig2 disappeared, presumably because it had become poly-ubiquitinated and degraded.

Snf1 controls galactose-induced protein degradation of Mig2

Snf1, the yeast homologue of mammalian AMP-activated protein kinases, is required for the transcription of glucose-repressed genes in S. cerevisiae [4]. Snf1 phosphorylates Mig1, which causes its translocation into the cytoplasm [21,33], and we asked if Snf1 additionally controlled protein degradation of Mig2. Consistent with a previous report [33], the galactose-induced electrophoretic mobility shift caused by phosphorylation of Mig1 was abolished in cells lacking SNF1 (Figure 3a, compare lanes 2 and 4). Upon a 20 min galactose induction in wild-type cells, the Mig2 protein band was greatly reduced and displayed an electrophoretic mobility shift similar to Mig1 (Figure 3a, compare lanes 1 and 2 with lanes 5 and 6), whereas Mig2 protein remained highly expressed and was not shifted in galactose-induced ΔSNF1 cells (Figure 3a, lane 8). Snf1 is activated by upstream kinases upon the shift from glucose to galactose medium by phosphorylation at Thr210 [4], and ΔSNF1 cells expressing HA–Snf1T210A in place of wild-type Snf1 are unable to grow on galactose plates (see Supplementary Figure S4 at http://www.BiochemJ.org/bj/435/bj4350641add.htm). Mig2 was not shifted and not degraded in galactose-induced cells expressing HA–Snf1T210A in place of wild-type Snf1 (Figure 3b, lane 2), indicating that catalytically active Snf1 is required to shift and degrade Mig2. In order to confirm that the shifted bands represent phosphorylated forms of Mig2, we treated extracts from galactose-induced wild-type cells expressing Mig2–HA3-H10 from the endogenous MIG2 locus with CIP in the absence and presence of EDTA, which chelates magnesium, thus inhibiting CIP. In the absence of EDTA, but not its presence, the treatment with CIP increased the mobility of Mig2 (Figure 3b, compare lanes 4 and 6), indicating that the shifted bands represent phosphorylated forms of Mig2. In order to confirm that Snf1 was required for conditional protein degradation of Mig2, we performed cycloheximide chase assays with endogenously tagged Mig2 protein in BY4742ΔWΔSNF1 cells. Mig2 was degraded upon a 5 min galactose induction in BY4742ΔW wild-type cells (Figure 3c, lanes 5–8), but Mig2 was stable in galactose-induced cells lacking SNF1 (Figure 3d, lanes 5–8), confirming that Snf1 not only controls cellular localization of Mig1 but also galactose-induced protein degradation of Mig2.

Figure 3 Snf1 controls galactose-induced Mig2 degradation

(a) Endogenous Mig1 (lanes 1–4) and Mig2 (lanes 5–8) proteins of BY4742ΔW (lanes 1, 2, 5 and 6) and BY4742ΔWΔSNF1 (lanes 3, 4, 7 and 8) cells were C-terminally tagged with three HA epitopes and ten histidine residues. Cells were grown in glucose (Glu) liquid medium to D600=1 (odd lanes) and induced for 20 min in galactose (Gal) liquid medium (even lanes). The upper panel presents a Western blot with an anti-HA antibody and the lower panel presents the same membrane that had been stripped and stained with Coomassie Brilliant Blue as loading control. Standard molecular masses are shown to the right of the blot in kDa (kD). (b) BY4742ΔWΔSNF1 cells expressing HA–Snf1T210A from the single-copy vector RS316 under the control of the ACT1 promoter were grown in glucose liquid medium to D600=1 (lane 1) and induced for 20 min in galactose liquid medium (lane 2). Extracts from cells of lane 6 from (a) were treated for 1 h with EDTA at 37 °C (lane 3), were incubated for 1 h at 37 °C (lane 4), were incubated for 1 h at 37 °C in the presence of CIP (lane 5) or were incubated for 1 h at 37 °C in the presence of both EDTA and CIP (lane 6). The upper panels present Western blots using an anti-HA antibody and the lower panels present the same membranes that had been stripped and stained with Coomassie Brilliant Blue as loading control. The added CIP protein is visible in the Coomassie staining. (c) BY4742ΔW wild-type cells expressing Mig2–HA3-H10 from the chromosomal Mig2 locus were grown in glucose liquid medium to D600=1 (lanes 1–4) and induced for 5 min in galactose liquid medium (lanes 5–8). Cycloheximide was added at t=0min (lanes 1 and 5) and the amount of Mig2 protein remaining in the cells after 5, 10 and 15 min was determined by Western blot using an anti-HA antibody (upper panels). The lower panels present the same membranes that had been stripped and stained with Coomassie Brilliant Blue as loading controls. (d) BY4742ΔWΔSNF1 cells expressing Mig2–HA3-H10 from the chromosomal Mig2 locus were grown in glucose liquid medium to D600=1 (lanes 1–4) and induced for 6 min in galactose liquid medium (lanes 5–8). Cycloheximide (cyclohex) was added at t=0min (lanes 1 and 5) and the amount of Mig2 protein remaining in the cells after 5, 10 and 15 min was determined by Western blot using an anti-HA antibody (upper panels). The lower panels present the same membranes that had been stripped and stained with Coomassie Brilliant Blue as loading controls.

Mig2 associates with the GAL1 promoter upon the galactose-induced exit of Mig1 in skp1dM cells

Endogenous Mig1 of BY4742ΔW cells had been C-terminally tagged with nine Myc tags and with three HA epitopes and ten histidine residues. The deletion of MIG1 causes a glucose repression defect of the GAL1 promoter (Figure 4a, compare lines 1 and 2), and glucose repression of the GAL1 promoter was intact in cells expressing Mig1–Myc9 and Mig1–HA3H10 in place of endogenous Mig1 (Figure 4a, lines 3 and 4), demonstrating that Mig1–Myc9 and Mig1–HA3H10 are functional. ChIP with anti-HA beads coupled with quantitative real-time PCR detected Mig1 at the GAL1 promoter in cells grown with glucose (Figure 4b). When cells were induced with galactose, Mig1 dissociated from the GAL1 promoter, presumably following its phosphorylation and nuclear exclusion upon galactose induction [21,22]. Endogenous Mig2 of JD52SKP1wt and JD52skp1dM cells was C-terminally tagged with nine Myc epitopes and with three HA epitopes and ten histidine residues. The deletion of MIG2 suppressed the gal phenotype of skp1dM cells (Figure 4a, compare lanes 6 and 9), and skp1dM cells expressing Mig2–Myc9 and Mig2–HA3-H10 in place of endogenous Mig2 displayed the gal phenotype (Figure 4a, lines 7 and 8), also demonstrating that Mig2–Myc9 and Mig2–HA3-H10 are functional. ChIP with anti-Myc beads coupled with quantitative real-time PCR failed to detect significant amounts of Mig2 at the GAL1 promoter in glucose-grown and in galactose-induced JD52SKP1wt cells (Figure 4b). Consistently and in agreement with a previous report [36], only the deletion of MIG1, and not the deletion of MIG2 (nor the deletion of MIG3), resulted in a glucose repression defect of the GAL1 promoter (see Supplementary Figure S5 at http://www.BiochemJ.org/bj/435/bj4350641add.htm). However, Mig2, which was not detected at the GAL1 promoter in glucose-grown skp1dM cells, associated with the GAL1 promoter in galactose-induced skp1dM cells (Figure 4b), indicating that SCF-mediated conditional protein degradation of the repressor Mig2 is required to prevent it from binding to the GAL1 promoter following the galactose-induced nuclear exit of Mig1.

Figure 4 Mig2 directly interfered with galactose induction of the GAL1 promoter in skp1dM cells

(a) The URA3 open reading frame was integrated into the GAL1 locus of wild-type BY4742ΔW cells (line 1), of BY4742ΔWΔMIG1 cells (line 2), of wild-type BY4742ΔW cells expressing Mig1–Myc9 in place of endogenous Mig1 (line 3), and of wild-type BY4742ΔW cells expressing Mig1–HA3H10 in place of endogenous Mig1 (line 4). Endogenous Mig2 of skp1dM cells expressing Nub-HA–Skp1dM from the SKP1 promoter was tagged with nine Myc epitopes (line 7), and three HA epitopes and ten histidine residues (line 8). Cells of the indicated genotype were titrated on to the depicted plates and incubated at 28 °C for 3 days on the glucose (Glu) plates and for 6 days on the galactose (Gal) plates. (b) Endogenous Mig1 was C-terminally tagged with three HA epitopes and ten histidine residues in wild-type BY4742ΔW cells. Endogenous Mig2 was C-terminally tagged with nine Myc epitopes in JD52 cells that expressed Nub-HA–Skp1wt and Nub-HA–skp1dM from the SKP1 promoter in place of endogenous Skp1. Cells were grown in glucose liquid medium to D600=1 and induced with galactose liquid medium for 4 h. Following cross-linking with formaldehyde and precipitation with anti-HA and anti-Myc beads respectively, chromosomal localization of Mig1–HA3H10 and Mig2–Myc9 relative to the untagged control strain was determined by real-time PCR with primers flanking the Mig1 sites in the GAL1 promoter. Error bars indicate the S.D. between three replicates. (c) Cells of the indicated genotype were grown in glucose liquid medium to D600=1 and induced with galactose liquid medium for 4 h and for 8 h as indicated. Total RNA was isolated and GAL1 mRNA was determined relative to ACT1 mRNA by quantitative real-time PCR. The value determined for SKP1wt cells grown with glucose was set as 1 and the error bars indicate the S.D. values between three replicates.

Real-time PCR quantification of GAL1 mRNA relative to ACT1 mRNA showed that galactose induction of the GAL1 mRNA was restored to some 20-fold in the absence of Mig2 in the skp1dM strain (Figure 4c). Our finding that the deletion of MIG2 only partially suppressed the transcription defect of the skp1dM strain indicates that wild-type Skp1 is required for the galactose-induced protein degradation of additional transcription factors.

Das1 targets mainly Mig2 for galactose-induced protein degradation

The F-box proteins of the SCF E3 ubiquitin ligases confirm substrate specificity [37], and in order to identify F-box proteins responsible for the degradation of Mig2, we screened S. cerevisiae BY4741ΔW strains deleted for the genes of 17 non-essential F-box proteins for a correlation of increased Mig2 protein expression and defects in galactose induction of the GAL1 gene. Endogenous Mig2 protein was tagged with nine Myc tags in 17 F-box protein gene deletion strains, and Mig2 was reproducibly and expressed at significantly higher levels in galactose-induced cells lacking the F-box proteins Das1 and Ufo1 (Figure 5a, compare lane 2 with lanes 4 and 6; see Supplementary Figure S6a at http://www.BiochemJ.org/bj/435/bj4350641add.htm). Thestrains were also 10-fold serially diluted and titrated on to galactose plates containing the respiration inhibitor antimycin A in order to screen for F-box proteins whose gene deletion caused the gal phenotype. Supplementary Figure S6(b) shows that cells lacking the F-box protein Ufo1 displayed the strongest gal phenotype, followed by cells lacking the F-box proteins Das1, Rcy1, Mdm30 and Ylr352w. Figure 5(b) shows that galactose induction of GAL1 mRNA relative to ACT1 mRNA was abolished in cells lacking Das1 and Ufo1, confirming the results of the plate assay. In cells lacking Das1, the additional deletion of MIG2 restored galactose induction of GAL1 mRNA to some 200-fold (Figure 5c), and Das1 interacted with Mig2 in the split-ubiquitin assay (see Supplementary Figure S2c), indicating that Das1 targets mainly Mig2 for galactose-induced protein degradation. In cells lacking Ufo1, however, the additional deletion of MIG2 had no effect on GAL1 gene induction (Figure 5c), indicating that Ufo1 targets additional proteins for galactose-induced protein degradation.

Figure 5 The F-box proteins Das1 targets mainly Mig2 for galactose-induced protein degradation

(a) Endogenous Mig2 protein was C-terminally tagged with nine Myc epitopes in BY4741ΔW (lanes 1 and 2) and in the isogenic gene deletion strains lacking the F-box proteins Das1 (lanes 3 and 4), Ufo1 (lanes 5 and 6) and Rcy1 (lanes 7 and 8). Cells were grown in glucose (Glu) liquid medium to D600=1. Half of the cultures were harvested (odd lanes), whereas the other half were induced with galactose (Gal) liquid medium for 1 h (even lanes). Western blot was performed with an anti-Myc antibody (upper panel). The membrane was stripped and reprobed with an anti-CPY (carboxypeptidase Y) antibody as loading control (lower panel). wt, wild-type. (b and c) BY4741ΔW cells of the indicated genotype were grown in glucose liquid medium to D600=1 (Glu) and induced with galactose liquid medium for 8 h (Gal). Total RNA was isolated and GAL1 mRNA was determined relative to ACT1 mRNA by quantitative real-time PCR. The value determined for BY4741ΔW wild-type cells grown with glucose liquid medium was set as 1 and the error bars indicate the S.D. values between three replicates.

Galactose-stable deletion derivatives of Mig2 prevent galactose induction of the GAL1 gene

In order to directly demonstrate that conditional degradation of Mig2 was required for galactose induction of the GAL1 gene, we performed internal deletions of Mig2, with the goal to produce a functional Mig2 protein derivative that remained stable upon galactose induction and whose over-expression inhibited growth on galactose plates [Mig (multi-copy inhibition of GAL gene expression) phenotype]. The computer program epestfi-nd (http://emboss.bioinformatics.nl/cgi-bin/emboss/epestfind) identified two potential PEST sequences in Mig2 (see Supplementary Figure S7a at http://www.BiochemJ.org/bj/435/bj4350641add.htm), but the deletion of either one of them had no influence on the persistence of Mig2 protein in galactose-induced wild-type BY4742ΔW cells (Figure 6a, lanes 10 and 12). Only the deletion of both PEST sequences resulted in a Mig2 protein derivative that remained stably expressed upon galactose induction (Figure 6a, lane 4), indicating that both PEST sequences were indeed functional. When PEST1 was deleted and PEST2 truncated by the deletion of five amino acids (ΔKFEIP), which abolished recognition of PEST2 by epestfind (see Supplementary Figure S7b), Mig2 protein was stably expressed in galactose-induced cells (Figure 6a, lane 6).

Figure 6 Galactose-stable Mig2 deletion derivatives prevented galactose induction of the GAL1 gene

(a) BY4742ΔW cells expressing the indicated HA–Mig2 derivatives under the control of the ACT1 promoter from the single-copy vector RS314 were grown in glucose liquid medium to D600=1 (odd lanes) (Glu) and induced with galactose liquid medium for 1 h (even lanes) (Gal). The upper panels present Western blots using an anti-HA antibody and the lower panels present the same membranes that had been stripped and stained with Coomassie Brilliant Blue as loading controls. Standard molecular massess are shown between the blots in kDa (kD). wt, wild-type. (b) BY4742ΔW cells expressing the indicated HA–Mig protein derivatives under the control of the ACT1 promoter from the multi-copy vector RS424 were serially diluted 10-fold, titrated on to the indicated plates and incubated at 28 °C for 3 days (Glucose) or 5 days with galactose and 1 μg/ml antimycin A (Galactose+AA). (c) Cells from lines 3, 4, 7 and 8 of (b) were grown in glucose liquid medium to D600=1 and induced with galactose liquid medium for 4 h. Total RNA was isolated and GAL1 mRNA was determined relative to ACT1 mRNA by quantitative real-time PCR. The value determined for BY4742ΔW cells containing the empty RS424 vector grown with glucose liquid medium was set as 1 and the error bars indicate the S.D. values between three replicates.

Consistent with a previous report [38], over-expression of Mig1 in the BY4742ΔW strain from the multi-copy vector RS424 under the control of the strong ACT1 promoter inhibited growth on galactose plates under anaerobic conditions (Figure 6b, compare lines 1 and 2). Expressing Mig2 from the same vector, however, did not significantly inhibit growth on the galactose plate (Figure 6b, compare lines 3 and 4), presumably because inside the cells on the galactose plate, Mig2 protein was not over-expressed but degraded. The deletion of either PEST1 or PEST2 did not affect growth on the galactose plate significantly (Figure 6b, compare line 3 with lines 5 and 6), but the simultaneous deletion of both PEST1 and PEST2 resulted in growth inhibition on the galactose plate containing antimycin A (Figure 6b, compare lines 3 and 7). The Mig2 derivative lacking PEST1 and the five amino acids KFEIP from PEST2 also inhibited growth on the galactose plate (Figure 6b, compare lines 3 and 8), resulting in a good correlation between protein stability of the Mig2 derivatives and their ability to inhibit growth on the galactose plate under anaerobic conditions. Real-time PCR quantification demonstrated that over-expression of the galactose-stable Mig2 derivative lacking both PEST sequences and of the galactose-stable Mig2 derivative lacking PEST1 and the five amino acids KFEIP from PEST2 eliminated galactose induction of the GAL1 mRNA (Figure 6c), confirming that galactose induction of the GAL1 gene requires Mig2 degradation.

DISCUSSION

The role of conditional protein degradation of transcription factors in the regulation of gene expression has been controversial. Some reports have correlated defects in the degradation of transcriptional activators such as Gal4 with defects in gene expression, suggesting that recycling of these activators could be required for the process of transcription [9,12,20], whereas others have argued that Gal4 remains stably bound to the GAL1 promoter during galactose induction [1315]. We have generated a gal skp1dM allele of the essential Skp1 component of the SCF E3 ubiquitin ligases that target proteins for degradation by the 26S proteasome [11] and used it for unbiased multi-copy suppressor screens. We have isolated Alpha2 as a multi-copy suppressor of the gal phenotype, but not of the ts phenotype, of the skp1dM strain. Alpha2 and Mig1 share the general repressor Tup1 [32], suggesting that wild-type Skp1 could be required for protein degradation of Mig1 and that the over-expression of Alpha2 might have suppressed the gal phenotype of the skp1dM strain by titrating Tup1 away from GAL1 promoter-bound Mig1. Further analysis, however, showed that Mig2, not Mig1, was degraded upon galactose induction and that this conditional protein degradation was abolished in the skp1dM strain. Mig2, similarly to Mig1, interacted with Tup1 in the split-ubiquitin assay, and the deletion of MIG2 partially suppressed the transcription defects of the skp1dM strain. The partial suppression indicates that wild-type Skp1 is required for the galactose-induced protein degradation of additional transcription factors. The 10-fold higher suppression achieved for the over-expression of Alpha2 as compared with the deletion of MIG2 suggests that promoter-bound Mig2, similarly to Mig1 [39], activates transcription in the absence of Tup1.

Snf1 is known to phosphorylate Mig1 upon galactose induction [33], resulting in the redistribution of Mig1 from the nucleus to the cytoplasm [21], but Snf1 has not previously been known tophosphorylate Mig2. Large-scale proteomic screens have failed to identify Mig2 as a target of Snf1 [40,41]. However, our findings in the present study strongly suggest that Mig2 is phosphorylated by Snf1, since we show that catalytically active SNF1 is required for the degradation of Mig2.

F-box proteins confer the substrate specificity to SCF E3 ubiquitin ligases [11], and a systematic analysis of 17 F-box protein gene deletion strains revealed that Mig2 remained highly expressed in galactose-induced DAS1 and UFO1 gene deletion strains. Both strains also displayed a strong gal phenotype and transcriptional activation of the GAL1 gene was abolished. The gal phenotype of these strains had been overlooked in a previous study [12] in which the F-box protein gene deletion strains had been grown under aerobic conditions. We have added the respiration inhibitor antimycin A to the galactose plates in order to achieve a more stringent selection, as anaerobic growth requires the cells to utilize more galactose. The transcription defect of the DAS1 gene deletion strain, but not of the UFO1 gene deletion strain, was suppressed by the deletion of MIG2, indicating that Das1 was specific for Mig2, whereas Ufo1 might target additional transcription factors for galactose-induced protein degradation. With the help of the split-ubiquitin assay, we were able to show that Das1 interacted specifically with Mig2 in vivo.

Sequence analysis of Mig2 protein with the computer program epestfind revealed two potential PEST sequences in Mig2. Deletion studies showed that both PEST sequences were indeed functional, as the deletion of both PEST sequences was required to produce a Mig2 deletion derivative that remained stably expressed in galactose-induced cells. This Mig2 deletion derivative displayed a strong Mig phenotype, indicating that the conditional degradation of Mig2 was required for galactose induction of the GAL genes. The deletion of the five N-terminal amino acids KFEIP of PEST2 was sufficient to eliminate the recognition of the remaining PEST2 sequence by epestfind. The protein remained stably expressed in galactose-induced cells and caused a strong Mig phenotype, indicating that those five amino acids were indeed required for PEST function.

ChIP studies showed that Mig1, but not Mig2, was bound to the GAL1 promoter in cells grown with glucose. Upon galactose induction, Mig1 left the GAL1 promoter, presumably following its relocalization to the cytoplasm [21,22]. Mig2, however, which was not found at the GAL1 promoter in SKP1wt cells, associated with the GAL1 promoter upon the exit of Mig1 in galactose-induced skp1dM cells. Apparently, Mig1 has a higher affinity for the GAL1 promoter than Mig2, and Mig1 and not Mig2 was bound to the GAL1 promoter in cells grown with glucose. Upon galactose induction, Mig1 was phosphorylated by Snf1 [4], left the GAL1 promoter and exited the nucleus. This allowed Mig2, which was present in galactose-induced skp1dM cells, but not in galactose-induced SKP1wt cells, to bind the GAL1 promoter and interfere with Gal4-mediated activation of the GAL1 gene. The present study shows that the conditional degradation of the repressor Mig2 is required for galactose induction of the GAL1 gene, which sheds new light on the conflicting reports about the functional role of the degradation of the transcriptional activator Gal4. The inhibition of the proteasome with the use of mutants or the addition of the inhibitor MG132 had stabilized Gal4 and decreased transcriptional activation of the GAL1 gene and of GAL1 promoter-based reporter constructs [9,12,20]. The results in the present study indicate that, also in those cases, the stabilization of the repressor Mig2, rather than the stabilization of the activator Gal4, might have been the cause for the reported defects in gene transcription.

AUTHOR CONTRIBUTION

Mei Kee Lim produced Figures 1(b), 1(c), 2, 4(c), 5 and 6 and Supplementary Figure S6. Wee Leng Siew produced Figure 3 and Supplementary Figures S3 and S4. Jin Zhao produced Figures 4(a) and 4(b) and Supplementary Figure S5. Ywee Chieh Tay produced Figure 1(a) and Supplementary Figure S1. Edwin Ang produced Figure 3(b). Norbert Lehming produced Supplementary Figures S2 and S7 and wrote the manuscript.

FUNDING

This work was supported by the Academic Research Fund (AcRF Tier 1) [grant numbers T13-0802-P16 and P23S-URC1-06].

Acknowledgments

We thank C. P. Hollenberg for reagents, T. Martin for suggestions and L. M. Chew for excellent technical assistance.

Abbreviations: ChIP, chromatin immunoprecipitation; CIP, calf intestinal alkaline phosphatase; HA, haemagglutinin; Mig phenotype, multi-copy inhibition of GAL gene expression phenotype; Nub, N-terminal half of ubiquitin; SCF, Skp1/cullin/F-box; SGT1, suppressor of G2 allele of skp1; skp1dM, Skp1V90A,E129A; Skp1wt, Skp1 wild-type; ts phenotype, temperature-sensitivity phenotype

References

View Abstract