Biochem. J. (2008) 412
(553562) (Printed in Great Britain)
Cholesterol binding is a prerequisite for the activity of the steroidogenic acute regulatory protein (StAR)
Alireza ROOSTAEE*,Élie BARBAR*, Jean-Guy LEHOUX* and Pierre LAVIGNE†1
*Département de Biochimie, Faculté de médecine et des sciences de la santé, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4, and †Département de Pharmacologie, Faculté de médecine et des sciences de la santé, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4
This supplementary data is also available as a PDF
Figure S1 Time-course study of the steroidogenic activity of the StAR proteins with mitochondria isolated from (A) Y-1 and (B) Leydig MA-10 cells in the presence of 200 μM cholesterol (Ch)
Figure S2 Cholesterol binding to StAR across a broad pH range
Binding of [3H]cholesterol (1 pmol) to N-StAR (25 μg/ml) was measured by separating bound from free [3H]cholesterol after 90 min incubation at 37 °C in PBS, at different pH values ranging from 7.5 to 2.5. The heat-denatured protein did not bind to cholesterol (control, broken line). The solid line represents the radioactivity in c.p.m., whereas the dotted line represents the binding percentage calculated relative to the control. Values are means±S.E.M. of three experiments.
Table S1 The PCR amplification primers used to generate N-StAR, C-StAR and N-StAR F267Q mutant
The corresponding cloning sites are indicated.
| Construct |
Forward primer 5′→ 3′ |
Reverse primer 5′→ 3′ |
Cloning sites |
| N-StAR |
ATTCTAGCTAGCCACCACCACCACCACCACCTGGAAGAGACTCTCTACAGTGACC |
CGGATCCTCAACACCTGGCTTCAGAGGC |
NheI, BamHI |
| C-StAR |
TTCGCGGATCCTGATCGTGGTGGTGGTGGTGGTGACACCTGGCTTCAGAGGC |
GGAATTCCATATGCTGGAAGAGACTCTCTACAGTGACC |
NdeI, BamHI |
| N-StAR F267Q |
GACCCAGGTGGATCAGGCCAACCACCTGCGCAAGCGCCTG |
CAGGCGCTTGCGCAGGTGGTTGGCCTGATCCACCTGGGTC |
NheI, BamHI |
Received 13 September 2007/13 March 2008; accepted 17 March 2008
Published as BJ Immediate Publication 17 March 2008, doi:10.1042/BJ20071264
© The Authors Journal compilation © 2008 Biochemical Society