About   Subscribe   Submit   My BJ   Librarians   Authors   Help
Editorial Board
Chair
PR Shepherd - Auckland

Vice Chair, The Americas
G Salvesen - La Jolla, CA

Vice Chair, Asia-Pacific
T Xu - Beijing

Vice Chair, Europe
DR Alessi - Dundee

Vice Chair, Reviews
A Toker - Boston, MA

Deputy Chairs - BJ Structure
J Ladbury - Houston, TX
KH Mayo - Minneapolis, MN

Editors - BJ Structure
TK Attwood - Manchester
BM Baker - Notre Dame, IN
P Booth - Bristol
AC Clark - Raleigh, NC
D Doyle - Oxford
P Fay - Rochester, NY
P Gettins - Chicago, IL
L Hedstrom - Waltham, MA
B Holland - Orsay
A Imberty - Grenoble
D Jordan - Peoria, IL
J Lakey - Newcastle upon Tyne
M Lemmon - Philadelphia, PA
B Mulloy - South Mimms
A Munro - Manchester
G Panayotou - Vari
G Pavitt - Manchester
LH Pearl - London
Z Radic - La Jolla, CA
D Richardson - Sydney
K Rittinger - London
JM Sanchez-Ruiz - Granada
R Sasisekharan - Cambridge, MA
N Savery - Bristol
J Sayers - Sheffield
FJ Sharom - Guelph, Ont.
WM Stark - Glasgow
D van Aalten - Dundee
MF White - St Andrews
Biochem. J. (2008) 412 (553–562) (Printed in Great Britain)
Cholesterol binding is a prerequisite for the activity of the steroidogenic acute regulatory protein (StAR)
Alireza ROOSTAEE*,Élie BARBAR*, Jean-Guy LEHOUX* and Pierre LAVIGNE†1
*Département de Biochimie, Faculté de médecine et des sciences de la santé, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4, and †Département de Pharmacologie, Faculté de médecine et des sciences de la santé, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4

This supplementary data is also available as a PDF



Figure S1 Time-course study of the steroidogenic activity of the StAR proteins with mitochondria isolated from (A) Y-1 and (B) Leydig MA-10 cells in the presence of 200 μM cholesterol (Ch)




Figure S2 Cholesterol binding to StAR across a broad pH range

Binding of [3H]cholesterol (1 pmol) to N-StAR (25 μg/ml) was measured by separating bound from free [3H]cholesterol after 90 min incubation at 37 °C in PBS, at different pH values ranging from 7.5 to 2.5. The heat-denatured protein did not bind to cholesterol (control, broken line). The solid line represents the radioactivity in c.p.m., whereas the dotted line represents the binding percentage calculated relative to the control. Values are means±S.E.M. of three experiments.



Table S1 The PCR amplification primers used to generate N-StAR, C-StAR and N-StAR F267Q mutant

The corresponding cloning sites are indicated.

Construct Forward primer 5′→ 3′ Reverse primer 5′→ 3′ Cloning sites
N-StAR ATTCTAGCTAGCCACCACCACCACCACCACCTGGAAGAGACTCTCTACAGTGACC CGGATCCTCAACACCTGGCTTCAGAGGC NheI, BamHI
C-StAR TTCGCGGATCCTGATCGTGGTGGTGGTGGTGGTGACACCTGGCTTCAGAGGC GGAATTCCATATGCTGGAAGAGACTCTCTACAGTGACC NdeI, BamHI
N-StAR F267Q GACCCAGGTGGATCAGGCCAACCACCTGCGCAAGCGCCTG CAGGCGCTTGCGCAGGTGGTTGGCCTGATCCACCTGGGTC NheI, BamHI

Received 13 September 2007/13 March 2008; accepted 17 March 2008

Published as BJ Immediate Publication 17 March 2008, doi:10.1042/BJ20071264


© The Authors Journal compilation © 2008 Biochemical Society

Chinese users - get faster access here
 
 
 
Make it personal - with My BJ!
Bookmark with:
Bookmark with Del.icio.us Bookmark with Connotea
 
 
Banner image courtesy G Salvesen, La Jolla